Home > Products > Human MicroRNA Agomir/Antagomir >
Human MicroRNA Agomir/Antagomir

Human MicroRNAs (hsa-miR-) are a class of non-coding single-stranded RNA molecules about 22 nucleotides in length encoded by endogenous genes. It is speculated that miRNAs regulate one-third of human genes.
Based on advanced nucleic acid chemistry synthesis technology, Human miRNA Agomir/Antagomir are advanced products of miRNA mimics/inhibitors. Human MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the human endogenous miRNA to regulate the biological function of the target gene. Human MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use Human MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
Cat.# | Name | Description | Stock | Price |
---|---|---|---|---|
AM5263 |
MIRacle™ hsa-let-7e-3p miRNA Agomir/Antagomir |
MicroRNA: hsa-let-7e-3p Accession Number: MIMAT0004485 Mature Sequence: CUAUACGGCCUCCUAGCUUUCC hsa-l...more | +inquiry | |
AM5264 |
MIRacle™ hsa-let-7f-5p miRNA Agomir/Antagomir |
MicroRNA: hsa-let-7f-5p Accession Number: MIMAT0000067 Mature Sequence: UGAGGUAGUAGAUUGUAUAGUU hsa-l...more | +inquiry | |
AM5265 |
MIRacle™ hsa-let-7f-1-3p miRNA Agomir/Antagomir |
MicroRNA: hsa-let-7f-1-3p Accession Number: MIMAT0004486 Mature Sequence: CUAUACAAUCUAUUGCCUUCCC hsa...more | +inquiry | |
AM5266 |
MIRacle™ hsa-let-7f-2-3p miRNA Agomir/Antagomir |
MicroRNA: hsa-let-7f-2-3p Accession Number: MIMAT0004487 Mature Sequence: CUAUACAGUCUACUGUCUUUCC hsa...more | +inquiry | |
AM5260 |
MIRacle™ hsa-let-7d-5p miRNA Agomir/Antagomir |
MicroRNA: hsa-let-7d-5p Accession Number: MIMAT0000065 Mature Sequence: AGAGGUAGUAGGUUGCAUAGUU hsa-l...more | +inquiry | |
AM5261 |
MIRacle™ hsa-let-7d-3p miRNA Agomir/Antagomir |
MicroRNA: hsa-let-7d-3p Accession Number: MIMAT0004484 Mature Sequence: CUAUACGACCUGCUGCCUUUCU hsa-l...more | +inquiry | |
AM5262 |
MIRacle™ hsa-let-7e-5p miRNA Agomir/Antagomir |
MicroRNA: hsa-let-7e-5p Accession Number: MIMAT0000066 Mature Sequence: UGAGGUAGGAGGUUGUAUAGUU hsa-l...more | +inquiry | |
AM5255 |
MIRacle™ hsa-let-7a-5p miRNA Agomir/Antagomir |
MicroRNA: hsa-let-7a-5p Accession Number: MIMAT0000062 Mature Sequence: UGAGGUAGUAGGUUGUAUAGUU hsa-l...more | +inquiry | |
AM5256 |
MIRacle™ hsa-let-7a-3p miRNA Agomir/Antagomir |
MicroRNA: hsa-let-7a-3p Accession Number: MIMAT0004481 Mature Sequence: CUAUACAAUCUACUGUCUUUC hsa-le...more | +inquiry | |
AM5257 |
MIRacle™ hsa-let-7a-2-3p miRNA Agomir/Antagomir |
MicroRNA: hsa-let-7a-2-3p Accession Number: MIMAT0010195 Mature Sequence: CUGUACAGCCUCCUAGCUUUCC hsa...more | +inquiry | |
AM5258 |
MIRacle™ hsa-let-7b-5p miRNA Agomir/Antagomir |
MicroRNA: hsa-let-7b-5p Accession Number: MIMAT0000063 Mature Sequence: UGAGGUAGUAGGUUGUGUGGUU hsa-l...more | +inquiry | |
AM5259 |
MIRacle™ hsa-let-7b-3p miRNA Agomir/Antagomir |
MicroRNA: hsa-let-7b-3p Accession Number: MIMAT0004482 Mature Sequence: CUAUACAACCUACUGCCUUCCC hsa-l...more | +inquiry | |
AM1895 |
MIRacle™ hsa-miR-3144-5p miRNA Agomir/Antagomir |
MicroRNA: hsa-miR-3144-5p Accession Number: MIMAT0015014 Mature Sequence: AGGGGACCAAAGAGAUAUAUAG hsa...more | +inquiry | |
AM1911 |
MIRacle™ hsa-miR-101-3p miRNA Agomir/Antagomir |
MicroRNA: hsa-miR-101-3p Accession Number: MIMAT0000099 Mature Sequence: UACAGUACUGUGAUAACUGAA hsa-m...more | +inquiry | |
AM1927 |
MIRacle™ hsa-miR-1343-5p miRNA Agomir/Antagomir |
MicroRNA: hsa-miR-1343-5p Accession Number: MIMAT0027038 Mature Sequence: UGGGGAGCGGCCCCCGGGUGGG hsa...more | +inquiry | |
AM1943 |
MIRacle™ hsa-miR-642a-5p miRNA Agomir/Antagomir |
MicroRNA: hsa-miR-642a-5p Accession Number: MIMAT0003312 Mature Sequence: GUCCCUCUCCAAAUGUGUCUUG hsa...more | +inquiry | |
AM1959 |
MIRacle™ hsa-miR-6799-3p miRNA Agomir/Antagomir |
MicroRNA: hsa-miR-6799-3p Accession Number: MIMAT0027499 Mature Sequence: UGCCCUGCAUGGUGUCCCCACAG hs...more | +inquiry | |
AM1975 |
MIRacle™ hsa-miR-3619-3p miRNA Agomir/Antagomir |
MicroRNA: hsa-miR-3619-3p Accession Number: MIMAT0019219 Mature Sequence: GGGACCAUCCUGCCUGCUGUGG hsa...more | +inquiry | |
AM1991 |
MIRacle™ hsa-miR-299-5p miRNA Agomir/Antagomir |
MicroRNA: hsa-miR-299-5p Accession Number: MIMAT0002890 Mature Sequence: UGGUUUACCGUCCCACAUACAU hsa-...more | +inquiry | |
AM2007 |
MIRacle™ hsa-miR-4798-3p miRNA Agomir/Antagomir |
MicroRNA: hsa-miR-4798-3p Accession Number: MIMAT0019975 Mature Sequence: AACUCACGAAGUAUACCGAAGU hsa...more | +inquiry |